Journal: FEBS letters

Article Title: Synthetic filaments assembled from C-terminally truncated alpha-synuclein.

doi: 10.1016/s0014-5793(98)01146-6

Figure Lengend Snippet: Fig. 1. K-Synuclein and various C-terminally truncated constructs. A: Diagram of the full-length 140 amino acid protein, showing re- peats and acidic C-terminal region, together with truncated proteins of lengths 130, 120 and 110 amino acids. B: Coomassie brilliant blue stained blot of puri¢ed K-synuclein constructs. C: Immunoblot with antiserum PER4 similar to that shown in B. Lanes 1: Full- length protein; 2: 1^110; 3: 1^120; 4: 1^130.

Article Snippet: Immunoblot analysis was carried out with anti-K-synuclein serum PER4 (diluted 1:1000) [9] and developed using a Vectastain kit (Vector Laboratories, Peterborough, UK).

Techniques: Construct, Staining, Western Blot

Journal: FEBS letters

Article Title: Synthetic filaments assembled from C-terminally truncated alpha-synuclein.

doi: 10.1016/s0014-5793(98)01146-6

Figure Lengend Snippet: Fig. 3. Immunolabelling of synthetic K-synuclein (1^120) ¢laments and ¢laments extracted from diseased brains, labelled with PER4 antiserum (A^E) and labelled with PER1 antiserum (F^I). A^C: K-Synuclein (1^120) ¢laments showing a labelled clump and individ- ual ¢laments. D^E: Filaments extracted from brains with di¡use Lewy body disease (D) or multiple system atrophy (E). F^I: Fila- ments end-labelled with PER1 antiserum, showing K-synuclein (1^ 120) ¢laments (F^H) and a ¢lament from a brain with multiple sys- tem atrophy (I). The 10-nm gold particles attached to the secondary antibody appear as black dots. Scale bar 100 nm.

Article Snippet: Immunoblot analysis was carried out with anti-K-synuclein serum PER4 (diluted 1:1000) [9] and developed using a Vectastain kit (Vector Laboratories, Peterborough, UK).

Techniques:

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 5 | 2-APB inhibits ER stress in HTV-treated mice. (A) Immunofluorescence photomicrographs of GRP78 (green) and CHOP (red) in lung tissues of group CON, HTV, and HTV+2-APB mice. Dapi (blue) was used to stain the nuclei. Scale bar: 200mm. An inset picture was employed to show the indicated area at 4X magnification. (B, C) Graphic presentations of fluorescence mean densities of GRP78 and CHOP. (D) Levels of GRP78, CHOP, p-IRE1a, t-IRE1a, TRAF2, XBP-1s, p-PERK, t-PERK, p-eIF2a, t-eIF2a, t-ATF6, b-actin proteins by Western blot. (E) Relative protein expression of GRP78, CHOP, TRAF2, XBP-1s and t-ATF6 relative to b-actin. (F) The relative ratio of p-IRE1a protein was presented to t-IRE1a. (G) The relative ratio of p-PERK protein was presented to t-PERK. (H) The relative ratio of p-eIF2a protein was presented to t-eIF2a. Data are expressed as means ± SD (n = 6 per group). *P < 0.05 vs. CON group. #P < 0.05 vs. HTV group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Staining, Western Blot, Expressing

Journal: Journal of advanced research

Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia.

doi: 10.1016/j.jare.2024.08.009

Figure Lengend Snippet: Fig. 4. SB supplement ameliorated TMAO-mediated activation of ER stress signaling and dysregulation of ionic signaling. (A) and (B) Representative images and statistical data show the expression of pPERK, PERK, pIRE1a, IRE1a, pNF-jB, NF-jB, pIP3R, IP3R, NCX, Kv1.5, and b-actin in HL-1 cells from control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. b-Actin was used as a loading control. *P < 0.05. **P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

Article Snippet: Then, the blots were incubated with primary antibodies against phospho-PERK (pPERK; #3179, Cell signaling), PERK (#3192, Cell signaling), phospho-IRE1a (pIRE1a; NB100-2323, Novus), IRE1a (#3294, Cell signaling Technology), phospho-NFjB (pNF-jB; #3033, Cell Signaling Technology), NF-jB (#8242, Cell Signaling Technology), phospho-IP3R (pIP3R; #3760, Cell signaling Technology), IP3R (#8568, Cell signaling Technology), NCX (MA3926, Thermo Fisher Scientific), Kv1.5 (APC-004, Alomone Lab), and b-actin (sc-47778, Santa Cruz).

Techniques: Activation Assay, Expressing, Control

Journal: Journal of advanced research

Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia.

doi: 10.1016/j.jare.2024.08.009

Figure Lengend Snippet: Fig. 8. SB supplement ameliorated atrial fibrosis and PERK/IRE1a/NF-jB axis of TMAO-treated mice. The expression of atrial fibrosis (blue area) was detected by Masson’s staining and immunostaining of pPERK, pIRE1a, and pNF-jB in the atrium tissues derived from mice gavage with control (n = 5), TMAO (n = 5), and TMAO combined with SB (n = 5). The expressions of pPERK are indicated by hollow arrowheads. (bar, 25 lm). ** p < 0.01. TMAO treatment versus control group or TMAO combined with SB treated group. (For interpretation of the references to colour in this Fig. legend, the reader is referred to the web version of this article.)

Article Snippet: Then, the blots were incubated with primary antibodies against phospho-PERK (pPERK; #3179, Cell signaling), PERK (#3192, Cell signaling), phospho-IRE1a (pIRE1a; NB100-2323, Novus), IRE1a (#3294, Cell signaling Technology), phospho-NFjB (pNF-jB; #3033, Cell Signaling Technology), NF-jB (#8242, Cell Signaling Technology), phospho-IP3R (pIP3R; #3760, Cell signaling Technology), IP3R (#8568, Cell signaling Technology), NCX (MA3926, Thermo Fisher Scientific), Kv1.5 (APC-004, Alomone Lab), and b-actin (sc-47778, Santa Cruz).

Techniques: Expressing, Staining, Immunostaining, Derivative Assay, Control

Journal: Neuroscience

Article Title: Daily morphine injection and withdrawal disrupt 24-h wheel running and PERIOD2 expression patterns in the rat limbic forebrain.

doi: 10.1016/j.neuroscience.2011.04.045

Figure Lengend Snippet: Fig. 3. Daily fluctuation of PER2-immunoreactive (IR) nuclei ( SEM) in rats killed 10 h after the last morphine or saline injection (at ZT13; black bars) or 22 h after the last injection (at ZT1; white bars) (M/last). PER2-IR cells counted in (from top to bottom panels) SCN, BNSTov, CEA, and dorsal striatum (n3 per condition per ZT). * indicates a significant difference. P0.05.

Article Snippet: Immunohistochemial staining for PER2 protein was carried out according to a rotocol described previously (Hood et al., 2010) using an affinityurified polyclonal antibody raised in rabbit against PER2, 1:4000 Santa Cruz Biotechnology, USA).

Techniques: Saline, Injection

Journal: Neuroscience

Article Title: Daily morphine injection and withdrawal disrupt 24-h wheel running and PERIOD2 expression patterns in the rat limbic forebrain.

doi: 10.1016/j.neuroscience.2011.04.045

Figure Lengend Snippet: Fig. 4. Daily fluctuation of PER2-immunoreactive (IR) nuclei ( SEM) in rats given vehicle injections for two evenings following the last saline (saline veh) or morphine (MW-2 veh) injection. Rats were killed 46 h (ZT1; white bars) or 58 h (ZT13; black bars) after the last morphine or saline injection. From top to bottom panels: mean PER2-IR nuclei in the SCN, BNSTov, CEA, and dorsal striatum (n3 per condition per ZT). * indicates a significant difference. P0.05.

Article Snippet: Immunohistochemial staining for PER2 protein was carried out according to a rotocol described previously (Hood et al., 2010) using an affinityurified polyclonal antibody raised in rabbit against PER2, 1:4000 Santa Cruz Biotechnology, USA).

Techniques: Saline, Injection

Journal: Neuroscience

Article Title: Daily morphine injection and withdrawal disrupt 24-h wheel running and PERIOD2 expression patterns in the rat limbic forebrain.

doi: 10.1016/j.neuroscience.2011.04.045

Figure Lengend Snippet: Fig. 5. Daily fluctuation of PER2-immunoreactive (IR) nuclei ( SEM) in rats injected with quinpirole (1.0 mg/kg) for two evenings following the last morphine or saline injection (quinpirole injected at ZT13). Rats were killed 46 h (ZT1; white bars) or 58 h (ZT13; black bars) after the last morphine or saline injection. The left panels show the effects of quinpirole on morphine-withdrawn rats (MW-2 Q) and the right panels show the effects of quinpirole on saline-treated rats (saline Q). From top to bottom panels on the left and right sides: mean PER2-IR nuclei in the SCN, BNSTov, CEA, and dorsal striatum (n3 per condition per ZT). * indicates a significant difference. P0.05.

Article Snippet: Immunohistochemial staining for PER2 protein was carried out according to a rotocol described previously (Hood et al., 2010) using an affinityurified polyclonal antibody raised in rabbit against PER2, 1:4000 Santa Cruz Biotechnology, USA).

Techniques: Injection, Saline

Journal: Neuroscience

Article Title: Daily morphine injection and withdrawal disrupt 24-h wheel running and PERIOD2 expression patterns in the rat limbic forebrain.

doi: 10.1016/j.neuroscience.2011.04.045

Figure Lengend Snippet: Fig. 6. Daily fluctuation of PER2-immunoreactive (IR) nuclei ( SEM) in rats injected with clonidine (0.1 mg/kg per injection) for two evenings follo- wing the last morphine or saline injection (clonidine injected at ZT11 and ZT13). Rats were killed 46 h (ZT1; white bars) or 58 h (ZT13; black bars) after the last morphine or saline injection. The left panels show the effects of clonidine on morphine-withdrawn rats (MW-2 CL) and the right panels show the effects of clonidine on saline-treated rats (saline CL). From top to bottom panels on the left and right sides: mean PER2-IR nuclei in the SCN, BNSTov, CEA, and dorsal striatum (n3 per condition per ZT). * indicates a significant difference. P0.05.

Article Snippet: Immunohistochemial staining for PER2 protein was carried out according to a rotocol described previously (Hood et al., 2010) using an affinityurified polyclonal antibody raised in rabbit against PER2, 1:4000 Santa Cruz Biotechnology, USA).

Techniques: Injection, Saline